EST details — SGN-E276655

Search information 
Request: 276655Match: SGN-E276655
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C66560Clone name: cLEN-14-K3
cartOrder Clone
Library Name: cLENOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: red ripe to over-ripe

Microarray: Alias clone SGN-C184259 is on microarray TOM1: SGN-S1-1-8.2.16.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184259 [TUS-44-F1] Trace: SGN-T198263 EST: SGN-E396937 Direction: 3' Facility: INRA
Clone: SGN-C184259 [TUS-44-F1] Trace: SGN-T198264 EST: SGN-E396938 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E276655Length: 433 bp (777 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E276655 [] (trimmed) GAAGAAATGGACTCCTAAAGAAAGCTTATGAACTTTCTATACTTTGTGATGCTGAAATTGCTCTTATTATTTTCTCTAGTCGNGGCAAGCTTTAT
GAATTTTGCAGCAATTCAAGTATGTCCAAGACATTGGAGAGATACCACAGATACAATTATGGTACACTTGAAGGAACCCAAACTTCATCAGATTC
ACAGAACAACTACCAAGAGTATTTGAAGCTTAAAACAAGAGTGGAAATGTTACAACAGTCTCAAAGGCATTTGCTAGGTGAGGATTTGGGACAAT
TGGGCACAAAAGACTTGGAACAGCTTGAACGTCAATTGGATTCATCATTGAGGCAAATTAGGTCAACAAAGACACAACACATTCTTGATCAACTT
GCTGAACTTCAACAAAAGGAACAATCTCTTACTGAAATGAACAAATCTTTGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E276655] SGN-U578471 Tomato 200607 Build 2 24 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T90201 [Download][View] Facility Assigned ID: TRRCA62TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0230 Quality Trim Threshold: 14.5