Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E275516

Search information 
Request: 275516Match: SGN-E275516
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C65476Clone name: cLEN-10-E20
cartOrder Clone
Library Name: cLENOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: red ripe to over-ripe

Microarray: Alias clone SGN-C180807 is on microarray TOM1: SGN-S1-1-4.2.17.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180807 [TUS-35-F5] Trace: SGN-T196383 EST: SGN-E395057 Direction: 3' Facility: INRA
Clone: SGN-C180807 [TUS-35-F5] Trace: SGN-T199713 EST: SGN-E398387 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E275516Length: 627 bp (864 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E275516 [] (trimmed) GGACAAAGTTCGAGATGCATCGGAGAAATGGGGTTTTTTCCAAGTGGTTAATCATGGGATTCCAACATCCGTCTTGGACAGAACGTTGCAAGGAA
CACGACAGTTCTTTGAGCAAGATAACGAGGTTAAGAAACAGTATTACACTCGAGATACTGCGAAAAAAGTGGTTTATACTAGCAATCTTGATTTG
TATAAATCTTCTGTTCCAGCTGCAAGTTGGAGAGACACGATTTTCTGTTACATGGCTCCGAATCCTCCCAGTCTACAAGAATTTCCAACTCCATG
CGGTTTAAATTTCTAGATCCGCCACTGCTCAGTTGATTGACTATCTAAAGACAGCAAAAATTCCTAGATCTGTCGCTGCTCAGTTGATTGAGTAT
CTAAATACAGCAAATTCTTAGATCCGCCATTGCTTAGTTGATTGACTATCTAAAGACGTCTGATTTTATATAAAAATATGTCATGTTTCAATGCA
GGGAGTCATTAATAGACTTCTCCAAGGATGTGAAGAAACTGGGATTCACTTTACTTGAATTATTGTCTGAAGGTCTCGGTCTCGATCGTAGTTAT
CTCAAAGATTATATGGATTGTTTTCATCTTTTTTGTTCTTGCAACTACTACCCACCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E275516] SGN-U580508 Tomato 200607 Build 2 40 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T89388 [Download][View] Facility Assigned ID: TRRBL34TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0085 Quality Trim Threshold: 14.5