Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E275491

Search information 
Request: 275491Match: SGN-E275491
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C65550Clone name: cLEN-10-I15
cartOrder Clone
Library Name: cLENOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: red ripe to over-ripe

Microarray: Alias clone SGN-C184225 is on microarray TOM1: SGN-S1-1-2.4.16.5
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184225 [TUS-44-D15] Trace: SGN-T198259 EST: SGN-E396933 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E275491Length: 339 bp (440 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E275491 [] (trimmed) GTGAGCTCTATTTTTTTTTCCCTCAGTTCACAACCAAATAATGGCGCCAAAATATACCTCCATCATTTTCCTCTTCCTTCTCTTCAACTCCTTTT
CATGTTCATTCGGAGGGGGTCATGATTATCATGACGCCCTCCGAAAAAGCATCCTGTTCTACGAAGGACAACGATCCGGAAAATTACCGCCGGAT
CAACGTATCAAATGGCGTAGAGACTCCGCATTACACGACGGTGCTTCCGCCGGAGTTGATTTGACAGGAGGCTATTACGATGCCGGAGATAATGT
GAAATTTGTTTTTCCGATGGCGTTTACGACGACATTGTTATCGTGGAGTATAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E275491] SGN-U585850 Tomato 200607 Build 2 38 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T89363 [Download][View] Facility Assigned ID: TRRBK56TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0051 Quality Trim Threshold: 14.5