Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E272403

Search information 
Request: 272403Match: SGN-E272403
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C61853Clone name: cLEM-19-K4
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C183142 is on microarray TOM1: SGN-S1-1-5.3.3.9
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183142 [TUS-41-G12] Trace: SGN-T196503 EST: SGN-E395177 Direction: 5' Facility: INRA
Clone: SGN-C183142 [TUS-41-G12] Trace: SGN-T199462 EST: SGN-E398136 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E272403Length: 431 bp (808 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E272403 [] (trimmed) GAGCAATAGCCAAATACCAAGCTGATCATGCCATCCCTGGCATGAACGAGGGGTCTAATCCAGTTGGTCCTACCCCTCACACCTTGCAGGAGCTG
CAAGATACCACCCTTGGTTCGTTATTATCAGCTTTGATGCAGCACTGTGATCCTCCTCAGAGAAGATTTCCATTGGAGAAAGGTGTTCCACCACC
ATGGTGGCCCACAGGAAAGGAGGATTGGTGGCCTCAATTGGGTTTGCAGAAGGACCAAGGTTCTCTACCTTACAAGAAGCCTCATGATCTGAAGA
AGGCGTGGAAGGTTGGTGTCCTAACAGCGGTGATCAAGCACATGTTCCCTGATATTGCTAAAATCCGCAAGCTGGTAAGGCAGTCAAAGTGCTTA
CAGGACAAGATGACAGCCAAGGAAAGTGCAACTTGGCTTGCCATCATCAGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E272403] SGN-U585761 Tomato 200607 Build 2 45 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T86401 [Download][View] Facility Assigned ID: TGFCV62TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0100 Quality Trim Threshold: 14.5