Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E271855

Search information 
Request: 271855Match: SGN-E271855
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C65147Clone name: cLEM-8-H19
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C178299 is on microarray TOM1: SGN-S1-1-8.1.4.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178299 [TUS-28-M17] Trace: SGN-T183322 EST: SGN-E370395 Direction: 3' Facility: INRA
Clone: SGN-C178299 [TUS-28-M17] Trace: SGN-T183323 EST: SGN-E370396 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E271855Length: 441 bp (955 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E271855 [] (trimmed) GGCTGCCCTATCTTTTTCTCCTACACAAACCCCCTTTCTCCTTTTCGGCGTTGCCGGCGGCGATCCTTTGTCTCGTCGGATCTCCGACCTATCCA
CCTTCCCTCTCCTCTCTTTATCATCTATCCTACTAAAAAATCGAAAAAAATTATCTATCGGAAAAACACATCAAAATTTTCTAGGGTTTCAGTAT
TTTTCTACTTCTATCAATTTCCAGTTCGATAGACGTCGGCTTTTTGAATTTATATATATTCTGAGATTTTGTATCTGCGAATAAAAAGAGGAGAG
GGAAGTCAGAAAAATAAAATCACAAAAAAAATCGGAAAACAGAAAATTATTTTTTTTGTTTTTGTGTTGAATTTTGATGGCGCAGGTTCAAGTGC
AGCCACAGGGTGCGAATGCTAGTGGTGTCAATCAGTTTGTGACGTCTCTGTACGTGGGTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E271855] SGN-U579015 Tomato 200607 Build 2 233 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T85406 [Download][View] Facility Assigned ID: TGFBE46TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.953 Expected Error Rate: 0.0084 Quality Trim Threshold: 14.5