EST details — SGN-E271490

Search information 
Request: 271490Match: SGN-E271490
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C64340Clone name: cLEM-5-N24
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C180878 is on microarray TOM1: SGN-S1-1-5.1.17.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180878 [TUS-35-I4] Trace: SGN-T1651 EST: SGN-E378580 Direction: 5' Facility: Giov. Lab
Clone: SGN-C180878 [TUS-35-I4] Trace: SGN-T193633 EST: SGN-E392307 Direction: 3' Facility: INRA
Clone: SGN-C180878 [TUS-35-I4] Trace: SGN-T193634 EST: SGN-E392308 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E271490Length: 519 bp (623 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E271490 [] (trimmed) GCAGATTTGGAGGCAGTGAAACCAATAGCGGAAGCCATGTTATGCGGCAGAATGCTATTGATGATGGGTGTAAATTGGTCCTTGGTTTGGGGCCA
ACACCTACAATATGTTCTAACGACTATTATCCTGGTGGATCTAATAAAAATAAAGGGTTTACAGCCTTGTTGAATCAGGGACAATTCTCTGAGAG
TGATTCTATCCTCAAACTTGGCCTCTCAGGGAGCACCGGTGAAATTTCTAATGCACTTGACTTTTCGGCTATCACTCAGAGTACTGCTGGTGCAC
CTCATCATATCGATCAGCTGTCTTCGGATGGTAAAAGGCCGGCGGTCCCTATCCTGGACGAAGGTTCAACATCAGCCAAGAAGTCTGGTGGGTAC
ATGCCTTCACTTCTTCTGGCTCCAAGAATTGAGAACAGCCAACTATCCTTCCAAAATAAGGAAGTTTCAGAGCTGGGTGCGAAATCCCATTTCCA
TCTCCCTGAGCTGAGCTCTGAGCCTTCTTGTATCTCTGACTACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E271490] SGN-U584619 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T85295 [Download][View] Facility Assigned ID: TGFAT84TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0029 Quality Trim Threshold: 14.5