EST details — SGN-E271305

Search information 
Request: 271305Match: SGN-E271305
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C64382Clone name: cLEM-5-P23
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C177989 is on microarray TOM1: SGN-S1-1-6.4.6.18
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177989 [TUS-27-P19] Trace: SGN-T183197 EST: SGN-E370960 Direction: 3' Facility: INRA
Clone: SGN-C177989 [TUS-27-P19] Trace: SGN-T183198 EST: SGN-E370961 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E271305Length: 364 bp (1055 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E271305 [] (trimmed) GGTTCTGAGAACAACTTATTTGTCGTGGAAGGCATGCAATTTGACCGTGGCTATATCTCTCCATACTTTGTTACGGACAATGAGAAGATGGTAGC
TGAATATGAAAACTGCAAGCTGCTTCTGGTAGACAAAAAGATAACAAATGCAAGGGATTTAGTCAATGTTTTGGAAGAAGCAATCAAGAATGGAT
ACCCAATATTGGTAATCGCTGAAGACATAGAACAGGAAGCTCTAGCCACACTTGTTGTCAACAAATTAAGAGGAGCATTGAAAATTGCTGCTCTC
AAAGCTCCTGGTTTTGGAGATCGAAAAAGCCAATATCTTGATGACATTGCTATCCTTACTGGAGGTACTGTCATTCGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E271305] SGN-U577323 Tomato 200607 Build 2 47 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T85110 [Download][View] Facility Assigned ID: TGFAS96TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0083 Quality Trim Threshold: 14.5