EST details — SGN-E271272

Search information 
Request: 271272Match: SGN-E271272
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C64179Clone name: cLEM-5-F7
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C177879 is on microarray TOM1: SGN-S1-1-4.4.6.9
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177879 [TUS-27-L5] Trace: SGN-T183169 EST: SGN-E370932 Direction: 3' Facility: INRA
Clone: SGN-C177879 [TUS-27-L5] Trace: SGN-T183170 EST: SGN-E370933 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E271272Length: 388 bp (1030 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E271272 [] (trimmed) ACCCAAAATCTAGGGAAAAAGCAAGATTTTGAGGTTTTTTGATAATTTTAGGAGGTGGGTGTGAATCTTTTTTGGGTAAATTTATAGTGGGATCA
AGAATGGTGTGTATAACTGAAGATATGATTAAGCAATTGCAGACTTCAATGGATGAAATTGCTGAGCCACTTCAGAAAACTTTCCAGAATGTATA
TCAGGGGTATCGAACCGAGACACTGGTGAGGTTTCTCAAAGCTAGAGATGGCAGTGTGTCTAAAGCACACAAGATGCTTGTTGACTGTTTAAATT
GGAGGATAGACAATGAGATCGATCAGATACTTGCAAAGCCAATTGTACCCACTGATTTTTATAGAGGAGTGAGGGACACTCAACTTGTGGGGATG
TCTGGATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E271272] SGN-U580243 Tomato 200607 Build 2 26 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T85077 [Download][View] Facility Assigned ID: TGFAS28TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.924 Expected Error Rate: 0.0189 Quality Trim Threshold: 14.5