EST details — SGN-E270757

Search information 
Request: 270757Match: SGN-E270757
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C64555Clone name: cLEM-6-H22
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C178106 is on microarray TOM1: SGN-S1-1-1.1.4.6
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178106 [TUS-28-E16] Trace: SGN-T183420 EST: SGN-E370230 Direction: 3' Facility: INRA
Clone: SGN-C178106 [TUS-28-E16] Trace: SGN-T183421 EST: SGN-E370231 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E270757Length: 511 bp (906 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E270757 [] (trimmed) GGAGATGTCCATCTTATTACAAAAAAATTGTGGATTTTAAGACATGGGAAATAGGATATCAACATTGTAGAGCTTCAATTGCTATCCTTGCTAAT
GTCTTACTCCATGTTTCTGATTTTAAAATGATAATGTTATATTGTTCGTGTTGCTTTGCTGAGTACTTTCTATTTTGTATGTCGTGCTAAGAGTG
AAATATGATATGAACGTGATAACTAAGAGCTACCTTTTACTGTTATGCAACATGTAAAAAATTATATTACAGTAAACCTATTGACAGAATTAGTG
AAGTCTTGTGTCTCCAAACTAAGTGAAACATATTTGAGTGAACAACTTCATCTTTTTCCTTTATCTAACATGCATATGACTTGTGTGAAACTGCA
CACCAGGTTTGCAATTCACATCCATCTTTCTACCTGATTTAATTTCTTAGATAATTGCAATCTTTGGTAACACTTTCCCTCGGTATTATCCAACA
CATAGTTGTTATGATATTTACCGAGTATTTCACTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E270757] SGN-U580153 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T84513 [Download][View] Facility Assigned ID: TGFAX47TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.936 Expected Error Rate: 0.0064 Quality Trim Threshold: 14.5