Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E270704

Search information 
Request: 270704Match: SGN-E270704
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C64455Clone name: cLEM-6-D13
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C183147 is on microarray TOM1: SGN-S1-1-8.3.3.13
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183147 [TUS-41-G17] Trace: SGN-T191491 EST: SGN-E390165 Direction: 5' Facility: INRA
Clone: SGN-C183147 [TUS-41-G17] Trace: SGN-T191702 EST: SGN-E390376 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E270704Length: 410 bp (921 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E270704 [] (trimmed) GATGGACCTTATTGTTAACAGTTTGTACAGCAACAAGGAGGTTTTTCTTAAGGAGCTTATCAGTAATGCGAGTGATGCCTTGGACAAGTTGAGGT
TTCTTGGTGTTACTGAGCCTGAGCTTTTGAAGGATGCAGTTGATCTTGATATTCGCATCCAAACCGACAAAGATAATGGCATTATTACCATAACG
GACTCAGGAATTGGTATGACTCGCCAAGAACTTGTCGACTGCCTTGGCACTATTGCACAAAGTGGAACTGCAAAGTTCCTAAAGGCCCTAAAAGA
CAGCAAGGATGCTGGTGCTGACAGCAATTTAATTGGTCAATTTGGTGTTGGATTCTACTCGGCTTTTCTTGTTTCTGAACGAGTTGAAGTCTCAA
CCAAAAGCCCCAAGTCTGACAAGCAATATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E270704] SGN-U584038 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T84460 [Download][View] Facility Assigned ID: TGFAW19TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0160 Quality Trim Threshold: 14.5