EST details — SGN-E270353

Search information 
Request: 270353Match: SGN-E270353
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C62041Clone name: cLEM-1-E24
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C177741 is on microarray TOM1: SGN-S1-1-6.2.6.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177741 [TUS-27-F11] Trace: SGN-T1461 EST: SGN-E378537 Direction: 5' Facility: Giov. Lab
Clone: SGN-C177741 [TUS-27-F11] Trace: SGN-T183143 EST: SGN-E370906 Direction: 3' Facility: INRA
Clone: SGN-C177741 [TUS-27-F11] Trace: SGN-T183144 EST: SGN-E370907 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E270353Length: 370 bp (700 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E270353 [] (trimmed) CCTGGGAAGAATTTTCTGGGCTTTCTACTCCTTTCTGTATCCTTGGTTGAATAGTAGGTGGCTTCCTCAACCTCTGATCCTTCCTGCTGAAGTCT
ACAAGGTTGGTGTCACTCATTACTTCTCTTTCCTAAAAGCAAAAGAGGAACTTGGTTACGTCCCAATGGTAAGTTCTAAGGAGGGCATGGCAGCA
ACAATTGCATATTGGCAAGAAAGAAAACGTATGAGTTTGGACGGACCTACAATATGGGCATGGCTGTTTTGTGTAATTGGAATGTTGGGGTTGTT
TGCTGCTGCATATCTGCCCGACTATGGACCCATTCCCTTAATTAGAGCAGTTCATCTCTTCTTCTTTCGCTCTATATTGGCGTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E270353] SGN-U565875 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T83726 [Download][View] Facility Assigned ID: TGFAB36TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 1.002 Expected Error Rate: 0.0349 Quality Trim Threshold: 14.5