EST details — SGN-E269466

Search information 
Request: 269466Match: SGN-E269466
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C63575Clone name: cLEM-2-B17
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C180786 is on microarray TOM1: SGN-S1-1-1.1.17.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180786 [TUS-35-E8] Trace: SGN-T193613 EST: SGN-E392287 Direction: 5' Facility: INRA
Clone: SGN-C180786 [TUS-35-E8] Trace: SGN-T193861 EST: SGN-E392535 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E269466Length: 449 bp (817 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E269466 [] (trimmed) TGCACCTTCAATTAGTGGAGCATCATCAGCTACTCCTGACGCATCTCCAGCACCATCTGTAAACGGAGATGAGGAAAGCCCACTTATTACTGAAG
TGTCAAAGTTGGAGTTGGTTGCTGACTATGCACCATCTGATACTCCTGAAGTGTCAAAGTCGAAGTTGGCTGCTGATGATGCACCATTTGATGCC
ACTGAAGTTTCAAAGTTGAAGTTGGCTGCTAACGACACTCCATCTGATACTACTGAAGTGTCAAAAGTGGAGTTGACTGCTGAGGACGCACCATC
TGATACTACTGAAGTATCACAAGTGGAGTTGGCTGCTGACAACGCACCATCTGATACTACCGAAGGGTCAAAATTGGAGTTGGCTGCTGACAACG
CACCATCTGATACTACTGAAGTGTTAAAACCAGAGTTGGCTGCTGAGGACGCACTGTCTGATACTACTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E269466] SGN-U578987 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T83931 [Download][View] Facility Assigned ID: TGFAG09TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0085 Quality Trim Threshold: 14.5