EST details — SGN-E269007

Search information 
Request: 269007Match: SGN-E269007
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C47569Clone name: cLEI-16-K22
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: Alias clone SGN-C177688 is on microarray TOM1: SGN-S1-1-3.4.6.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177688 [TUS-27-D6] Trace: SGN-T193006 EST: SGN-E391680 Direction: 3' Facility: INRA
Clone: SGN-C177688 [TUS-27-D6] Trace: SGN-T193007 EST: SGN-E391681 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E269007Length: 512 bp (856 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E269007 [] (trimmed) CTGGCCAACCTCTAGTAAAATTTGAGCAATATGGTGGATACATTACGATCGATGAATTTGCTGGTCGCGCTTTTTATTATTACTTTGTTGAAGCT
CAACATTCTAAGAAGTCATTGCCTCTTCTTCTATGGCTTAATGGAGGTCCAGGTTGTTCTTCTCTGGCATATGGAGCTTTTCAAGAACTTGGACC
ATTTAGAGTAAATAGTGATGGAAAAACACTTCACATAAATAATTTCGCATGGAACCATGCTGCCAATGTGTTGTTCGTGGAGTCTCCAGCTGGAG
TTGGATTTTCATACTCTAATACATCAAGCGATGTTAAGATTGGAGGAGACAGGAAAACAGCTAATGACAATTATCTATTTATAATAAATTGGCTC
GAAAGGTTTCCTGAATATAAAGATAGAGATTTTTACATAGCTGGAGAGAGTTACGCGGGACATTACGTACCTCAATTGGCACATACAATTTTGTA
TCACAACAAGAAGGCTAACAAGAATATCATTAATCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E269007] SGN-U586216 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T83231 [Download][View] Facility Assigned ID: TGSCJ71TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0021 Quality Trim Threshold: 14.5