EST details — SGN-E266296

Search information 
Request: 266296Match: SGN-E266296
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C48039Clone name: cLEI-3-D16
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C188775 [TUS-56-B5] Trace: SGN-T338334 EST: SGN-E537459 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C188775 [TUS-56-B5] Trace: SGN-T338337 EST: SGN-E537462 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E266296Length: 475 bp (708 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E266296 [] (trimmed) CGAATGGTTCCATGGTTGTGCATCTTTTTTTCTTACTGGTTGATCTACAAGTCAAGTCGTGAGCTTATAACTTCTCTTCCTGGACAACCTCCAAA
TATATTCTTCAAACAACACTCTGGTTATATTGTTACAAATTCTCGCAATGGTCGAGCTCTCTTTTATTATTTTGTAGAACCGGATTCAGAAAATG
CAACATCACTTCCCCTTACTCTGTGGCTCAATGGAGGCCCTGGTTGTTCATCTGTGGGGTTCGGTGTTTGTATGGAACATGGTCCATTTCAGCCA
GGAAAAGATGGGAGACTAATAAAAAACACGTATTCTTGGAATTTAGAATCGAACATGCTATACGTTGAGTCCCCGATTGGAGTAGGATTTTCATA
CTCGAATACAAGCTCGGACTACGTCAATTGCGATGATGTTGCAACAGCAAAGGAGAATCTCCAATTTCTACTCAACTGGTTAGAGAAATTCCCCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E266296] SGN-U567319 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T79984 [Download][View] Facility Assigned ID: TGSAL20TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0227 Quality Trim Threshold: 14.5