EST details — SGN-E265964

Search information 
Request: 265964Match: SGN-E265964
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C48965Clone name: cLEI-6-I12
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C188904 [TUS-56-G14] Trace: SGN-T338555 EST: SGN-E537680 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C188904 [TUS-56-G14] Trace: SGN-T348807 EST: SGN-E547932 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E265964Length: 336 bp (830 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E265964 [] (trimmed) TGAATCTAAAGGTAAAGGTGGATTCAAAAGGGCTAGGCTTAGATTCACCGCAATTTCACCACGCACAAGAGTGAGGTTTTTGAGCACGTATTATC
ATATGAAGAGTGATAATTCGGGTTCCTTGTGTGGTCCTGTGGTCGATGATGTGAGATTGGTAGGACTTCGCAATCCCCACCTTCCATAAGTCTTT
TTATTGATTGAGTTTAAGTTTTATGCATGACGGAACACTGTGATGTTATTAGTTCATTGGAATGTGTGTCATAGTTGATGTGTTGTTGCTTCTTT
TTTTTTTCATGTCATAGAAACAAGAGAGTTAAAATGATGTACTTTTACATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E265964] SGN-U577501 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T80750 [Download][View] Facility Assigned ID: TGSAV54TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.949 Expected Error Rate: 0.0053 Quality Trim Threshold: 12.5