EST details — SGN-E259692

Search information 
Request: 259692Match: SGN-E259692
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C37453Clone name: cLEG-42-B3
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C177444 is on microarray TOM1: SGN-S1-1-7.2.7.18
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177444 [TUS-26-J2] Trace: SGN-T182655 EST: SGN-E370041 Direction: 3' Facility: INRA
Clone: SGN-C177444 [TUS-26-J2] Trace: SGN-T182656 EST: SGN-E370042 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E259692Length: 370 bp (943 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E259692 [] (trimmed) AAACAACAAAACTACATCCCCTCCTCCTCCCATCATGGCTCAACCCGAGCAACAATGGCCAATTCCTCAAAATCAACTTCACCAGCAAAATCGTG
ATCATCATCACGATAATGAAAGCGACAGCATGGATCACGATTTGGAAGAGGACGAGGATGAGGACGAAGAAGATGAAGGTAATGGCTATGAAATA
ATAATCACAAATAAACAACAATCATCATCAATGGCGGCTACCCCAGTAACAACAACAACTTCTGCTGCTGCAGTTTAAAGCACAAAATTAAAATT
GATAACAACATAAACAGCAGTAGTTACTGTGCATTGGGAATGGCAAGTTGGGCAACAGATTGTGCAGAGAATTGTCGTATTGGGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E259692] SGN-U575103 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T72453 [Download][View] Facility Assigned ID: TBFGK02TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.943 Expected Error Rate: 0.0259 Quality Trim Threshold: 14.5