EST details — SGN-E259492

Search information 
Request: 259492Match: SGN-E259492
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C37461Clone name: cLEG-42-C12
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C177447 is on microarray TOM1: SGN-S1-1-4.2.7.18
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177447 [TUS-26-J5] Trace: SGN-T182576 EST: SGN-E369962 Direction: 3' Facility: INRA
Clone: SGN-C177447 [TUS-26-J5] Trace: SGN-T182577 EST: SGN-E369963 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E259492Length: 303 bp (943 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E259492 [] (trimmed) GGGGAAAGGGGGGGCCAAAATTTCATATTTATCCTTTTTAAAAATTTAAAAAAAAAATCATTTCCCAATGGACCATTTTTTACCCCAAAAATTAC
ATGCTTACTCAAATTTCACAAAAAACGTAACTTCCCAAAATAAAACAGTTAACTTTTTTGAAAAATATGCCTAGTTTTGGCCCCTAGGAACAACA
AAAGCAATTATTAACAGCCCCCCAACCACAAGGGGGAATTGGCCTTTTTTTTAAAAAATTTCCTTTTTGGATTAAAAAGGGGACCCTTTTTTGTT
ATCCTTGAGTGGGGGACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E259492] SGN-U602923 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T72253 [Download][View] Facility Assigned ID: TBFGJ18TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.854 Expected Error Rate: 0.0384 Quality Trim Threshold: 14.5