Notice: the solgenomics has been unstable, we apologize for the inconvenience.

EST details — SGN-E258863

Search information 
Request: 258863Match: SGN-E258863
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C37377Clone name: cLEG-41-O11
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C177407 is on microarray TOM1: SGN-S1-1-4.4.7.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177407 [TUS-26-H13] Trace: SGN-T182491 EST: SGN-E369877 Direction: 3' Facility: INRA
Clone: SGN-C177407 [TUS-26-H13] Trace: SGN-T182492 EST: SGN-E369878 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E258863Length: 425 bp (883 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E258863 [] (trimmed) TTCTGAAGGGAAATGTGGTTGTTGCAAAAAATCCATGCTTGCATCCTGGTGATATTCGTGTTTTAAAGGCTGTAAATGTTCGAGCGCTGCACCAC
ATGGTAGATTGTGTTGTATTCCCTCAGAAAGGAAAAAGACCTCATCCGAATGAATGTTCTGGGAGTGATTTGGATGGGGATATCTACTTTGTTTG
CTGGGATCAAGACATGATCCCGCCAAGGCAAGTCCAGCCGATGGAATATCCTCCAGCACCCATCATACAGTTGGACCATGATGTCACAATTGAGG
AAGTTGAAGAGTACTTCACCAACTATATTGTGAATGACAGTTTGGGAATCATAGCAAATGCCCATGTCGTATTTGCAGACAGAGAACCTGATATG
GCCATGAGTGATCCATGCAAAAAACTTGCTGAGCTCTTTTCAATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E258863] SGN-U577143 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T71895 [Download][View] Facility Assigned ID: TBFGE90TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0111 Quality Trim Threshold: 14.5