EST details — SGN-E256010

Search information 
Request: 256010Match: SGN-E256010
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C35540Clone name: cLEG-35-F23
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C180883 is on microarray TOM1: SGN-S1-1-8.1.17.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180883 [TUS-35-I9] Trace: SGN-T187492 EST: SGN-E375724 Direction: 3' Facility: INRA
Clone: SGN-C180883 [TUS-35-I9] Trace: SGN-T187493 EST: SGN-E375725 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E256010Length: 507 bp (849 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E256010 [] (trimmed) CTCGTTTGATGCAGCGATTGCTGCTCATATATATAAACATCAAAGCAAAGCTGATTCTCAGATGGCTCTTCCACCTCAAGCATCTTCCATTTGGA
ATGCTGAAGATACATGTGATGCTTTTGCATTCAAGAAAAATGTTGCTTTCAGTGACAAATCGCAGTGTTCATCCAGCAATGTTGGTGCAGAGAAT
TCCCAGCGGATTGCTCAGTCATCTTCCCTGGTATTGGATGCAGTAATCAAGGATTTGCCTGGGAACATGGAGTCCTTTAACGGTGAACCTGCTCA
TGATGACGCAGTGGATGAGTGTCAATCGGATGCACAGGCGTTGGATGGTTCTTCAAAGGATCTTAATGGGCTCTCTGGCATATATTGGACAGACT
CTTTAGGACCGCTAGAACTGGACGCTCCTTCATGTAGATATCATAGTGAAGACATAACTCTGAGTGATAGTCTTGGTGGTTTTAACCGCCTCATA
GTTAACAGTCTAGATGCATTCCAAAATTGCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E256010] SGN-U581842 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T70494 [Download][View] Facility Assigned ID: TBFFI36TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.981 Expected Error Rate: 0.0032 Quality Trim Threshold: 14.5