EST details — SGN-C25470

Search information 
Request: 25470Match: SGN-C25470
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C25470Clone name: cLEF-12-J19
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C180353 is on microarray TOM1: SGN-S1-1-2.3.19.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180353 [TUS-34-C7] Trace: SGN-T199140 EST: SGN-E397814 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E243277Length: 444 bp (749 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E243277 [] (trimmed) GGCTAGCTTCTGTTGAAGCACAAGTTGTACTTGTGTTTCATCTCAAATCGATCATCAAAATACAATAATTAGGTGAAATAGCTTCTCTGTTTGAA
GCTTTACTCTCCAGTTTCTTCTGATTCGCGGAGAGGCAAAATGGGTCAAGCCTTTCGCAAGCTGTTCGATACTTTCTTCGGCAATTCTGAGATGA
GGGTTGTAATGCTTGGCCTTGATGCGGCTGGAAAAACAACTATATTATACAAACTGCACATAGGAGAAGTTCTATCAACAGTTCCTACTATCGGA
TTCAACGTGGAAAAAGTACAGTACAAAAATGTAATTTTTACTGTGTGGGATGTTGGTGGACAAGAGAAATTAAGGCCACTGTGGAGACATTACTT
CAATAACACAGATGGATTGATTTATGTCGTCGACTCTTTGGATCGAGAGAGGATTGGAAAGGCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E243277] SGN-U574089 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T59474 [Download][View] Facility Assigned ID: TMGBU58TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0108 Quality Trim Threshold: 14.5