EST details — SGN-E253423

Search information 
Request: 253423Match: SGN-E253423
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C32901Clone name: cLEG-24-H21
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C180330 is on microarray TOM1: SGN-S1-1-1.2.19.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180330 [TUS-34-B8] Trace: SGN-T187198 EST: SGN-E375430 Direction: 3' Facility: INRA
Clone: SGN-C180330 [TUS-34-B8] Trace: SGN-T187199 EST: SGN-E375431 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E253423Length: 465 bp (934 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E253423 [] (trimmed) GTTCTGGGTACTGGTAAGATTTTGCTCAAGGTTCCTCCAACTATGGGATTTGTATTGGATGGTGAAATTCCGAATTACATACTAGCTAAGGATTT
GATTTTGCAAGTTATTGGTGAAATTTCTGTAGCTGGTGCAACATACAAAACAATGGAATTTGTCGGTACTGCTGTTGAAAGTTTAACAATGGAAG
AGAGAATGACATTATGCAATATGGTTATCGAAGCTGGTGGAAAGAATGGTGTTATTCCTGCTGATAAAACAACATATGACTACCTTAAGGACAAG
ACTACTGTGCATTATGAAGGTGTCTACAGTGATGAGCAAGCCAGGTTTCTTGCTAAGTATCATTTCGACATCTCAAAGTTGGAGCCCTTAGTAGC
AAAGCCTCATTCTCCTGGCAATCGTGCTTTGGCAAGAGAATGCGAAGATGTTAAGATTGACAGAGTATATATTGGATCTTGTACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E253423] SGN-U576272 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T67671 [Download][View] Facility Assigned ID: TBFDQ47THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0209 Quality Trim Threshold: 14.5