EST details — SGN-E252370

Search information 
Request: 252370Match: SGN-E252370
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C31266Clone name: cLEG-12-M9
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C185110 is on microarray TOM1: SGN-S1-1-5.1.12.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185110 [TUS-46-I12] Trace: SGN-T1868 EST: SGN-E378472 Direction: 5' Facility: Giov. Lab
Clone: SGN-C185110 [TUS-46-I12] Trace: SGN-T196589 EST: SGN-E395263 Direction: 5' Facility: INRA
Clone: SGN-C185110 [TUS-46-I12] Trace: SGN-T199000 EST: SGN-E397674 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E252370Length: 500 bp (866 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E252370 [] (trimmed) GAAAGCTTAAGAGTGGGTGATCCTACTGTTAAGCAAGTCGATCTTCAACCAGGCTCAATTGAGCTACTCCGTGTTGACTCAGCTGCAGAGGTTTG
TTGCGTTACTTTTGTTTTAAATTACAAACACGCGCTTAATCTGCAGTCCCAAAACTTGTTTAGCTATTGTGCAGTTGGATATAGAAGCCTCATTT
GAAGTGGACAAAGTCGCGCTTCAAGGAATAATTGAAGCAGATCATGTAGGTTTCAGTTGCTCTACTAGTGGAGGTGCTGCTAGCAGAGGCATTTT
GGGACCATTTGGTGTCATAGTAATTGCTGATCAAACGCTATCTGAGCTAACGCCAGTTTACTTTTACATTTCTAAAGGAGCTGATGGTCGTGCAG
AGACTCACTTCTGTGCTGATCAAACTAGGTTTGCTTTTCTATCTGGCACAATTAATTTGTCCTTGTAAAATGGAGATGGATAAAAGTAGCGGGTT
GTTGATCTGATATATGCAGATCCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E252370] SGN-U580029 Tomato 200607 Build 2 22 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T66180 [Download][View] Facility Assigned ID: TBFBS77TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0065 Quality Trim Threshold: 14.5