EST details — SGN-E248546

Search information 
Request: 248546Match: SGN-E248546
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C30679Clone name: cLEF-59-H6
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C182524 is on microarray TOM1: SGN-S1-1-7.1.7.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182524 [TUS-39-M18] Trace: SGN-T195269 EST: SGN-E393943 Direction: 3' Facility: INRA
Clone: SGN-C182524 [TUS-39-M18] Trace: SGN-T195269 EST: SGN-E398829 Direction: 3' Facility: INRA
Clone: SGN-C182524 [TUS-39-M18] Trace: SGN-T195270 EST: SGN-E393944 Direction: 3' Facility: INRA
Clone: SGN-C182524 [TUS-39-M18] Trace: SGN-T195271 EST: SGN-E393945 Direction: 5' Facility: INRA
Clone: SGN-C182524 [TUS-39-M18] Trace: SGN-T200135 EST: SGN-E398830 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E248546Length: 619 bp (885 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E248546 [] (trimmed) AGATAAAAACAACCCATGTTCACTTTTTCTCTCTCTAAACATTGAAATTCAACCAAAACAAAAAACAAAAGTTGATAAGAATCCTTTCTTTCTTT
CTTTGTGTGTGTGTGTGTCTAGCTAGGGTTTGCATTTCTTTCACAATTTTGGTTGTTTCAGTAGGAGAGAAAAGAGGATCTAAGAGTTAGCCAAG
AGAAGAAATTAGTGAGAAAATAAAGTAGAAAAAGATCATCAGAGGAAGGAGGGATGGGTAGAGGAAGAGTTGAGCTGAAGAGGATAGAAAACAAG
ATAAATAGACAAGTCACTTTTGCAAAGAGGAGAAATGGATTGCTCAAAAAAGCTTATGAACTATCTGTGCTTTGTGATGCTGAAGTTGCTCTACT
CGTTTTCTCTAATCGTGGAAAACTCTATGAATTCTGCAGCACAAACAATATGCTCAAAACACTTGATAGGTACCAAAAGTGCAGCTATGGAACAT
TGGAAGTCAATCGATCAATCAAAGATAATGAGCAAAGCAGCTATAGGGAATACTTGAAACTCAAAGCCAAATATGAGTCGCTGCAGCGATATCAA
AGACACCTTCTTGGAGATGAGTTGGGGCCTCTGACTATAGATGATCTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E248546] SGN-U581481 Tomato 200607 Build 2 89 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T64328 [Download][View] Facility Assigned ID: TMGJB39TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.945 Expected Error Rate: 0.0032 Quality Trim Threshold: 14.5