EST details — SGN-E247653

Search information 
Request: 247653Match: SGN-E247653
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C26963Clone name: cLEF-42-C1
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176541 is on microarray TOM1: SGN-S1-1-6.4.9.14
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176541 [TUS-24-D11] Trace: SGN-T1409 EST: SGN-E378679 Direction: 5' Facility: Giov. Lab
Clone: SGN-C176541 [TUS-24-D11] Trace: SGN-T193118 EST: SGN-E391792 Direction: 5' Facility: INRA
Clone: SGN-C176541 [TUS-24-D11] Trace: SGN-T193365 EST: SGN-E392039 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E247653Length: 527 bp (953 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E247653 [] (trimmed) TGCAATTGCTGATAACCTATGCGAGGTTTCTGCAAAAGGACAGATTCAAACAGTCTGCTGGGATAATCTTGGTCTTACACTTGCTGCAACCCTGA
ACATACTGTCTGCTAATAATCCAAGATTGCAGGCTGGTCTACCATTTGTGATGTACCCTGTCTTCTCTGTGCTTGACCTTTTTGGTATTTATCAA
GGACTAAAGCATGTGCATCTGCAGACATTAACTAAGGATAGGCTTAACATCATTATAAGCACATGGATTCAACAAGGATTTGTCCCATCTCCTGA
AGAGGTGAGTAAACAGGAGGGTATTGGCTTATCTTGGAGCAGAGGTAATTTTTAACTTAAATTTTGCCGTAACAAGGCCTTATTGCTTGGTTTAT
CGCTACATTTTTAGTAAAGGAACATTCTTAATCAGCTTTAATCAGGCAGAGAGCCATGGTCAATCAGAATTGGTTGCTTAAATCCTAGACGTTGC
ACAGCAAAGCTATTCTGTGATGACGATGCAATCTTTGAATACTGAAGACTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E247653] SGN-U563820 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T60697 [Download][View] Facility Assigned ID: TMGGI13TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0139 Quality Trim Threshold: 14.5