EST details — SGN-E247560

Search information 
Request: 247560Match: SGN-E247560
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C26959Clone name: cLEF-42-B3
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176538 is on microarray TOM1: SGN-S1-1-1.4.9.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176538 [TUS-24-D8] Trace: SGN-T193420 EST: SGN-E392094 Direction: 3' Facility: INRA
Clone: SGN-C176538 [TUS-24-D8] Trace: SGN-T193421 EST: SGN-E392095 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E247560Length: 530 bp (969 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E247560 [] (trimmed) AAAACCCAACTTTTTCATCCGTGACCTAACGACGAAACTTCCATGTGTCTACACAAAACTTTTAACTCACATACTGTTTTAATTATATAGAAAAA
AAAAAAGTGTATTCCCTTTCTGATACTGCAATTTTTTTTCAAACAGATTCGATTCGATCCACCATTAGAATCCAATAATCACAAGTTTTTAAACC
CCACAACTCCAATTGCTGCACATCCTCTGTTTTTAAGATAAGTTGACTTTGATGGGTGGCAAGAGTTCAAGAGAGGATAGTTGGAGGCAAGCTTC
ATCGACTCGATCTTCCTCTTGGAATCAATACGATTATCCTCAAACTGCTTATCCTCAAGATAGTTACAGTTACTCACAGCAGACGGCTGTTCCTT
CTTATGCACCACCACCACCATCCCAACAGAATTATCCCCCACAGCACCAACACAATTATTCTTCACAACCCCAACAGAATTATGCTTCTCATGAA
CATGAATCTCGGACTCATACTCATGCTCCACGACCAAAGCTTGATCGGAGATACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E247560] SGN-U577065 Tomato 200607 Build 2 35 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T60604 [Download][View] Facility Assigned ID: TMGGK02TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.953 Expected Error Rate: 0.0038 Quality Trim Threshold: 20.5