EST details — SGN-E247487

Search information 
Request: 247487Match: SGN-E247487
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C26966Clone name: cLEF-42-C13
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176543 is on microarray TOM1: SGN-S1-1-4.4.9.14
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176543 [TUS-24-D13] Trace: SGN-T193119 EST: SGN-E391793 Direction: 5' Facility: INRA
Clone: SGN-C176543 [TUS-24-D13] Trace: SGN-T193366 EST: SGN-E392040 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E247487Length: 350 bp (951 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E247487 [] (trimmed) TAGACGCCGTCAATTTGGTCATACCCCGTTAATATTCCCTCCCTTGGGCCGTCTGAATTTTCATTGATAAAAATGGCACTGTATCGCCGCCTTTC
TCGGAATCGCCATGTCTTCCGTCGGCACGCTATCTCTGCTCTGTATTCCTCCGGCGACCTAATAAACCCTAACGCGACTGTTGTTTATTCTCCGT
TCATAAACCCCCTTCAATTTTCTTCTTCTGATGATCATAATCACACCCTCAATTCTAGAAAATTGTTGACATTATACCCTTCACATTCTTCAAGA
ATCGAACTTTCAGGGTTCCGCCAAGTTCTTTACTTTTCAACATTACCTGATTCCGAAGAGGAGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E247487] SGN-U583985 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T60531 [Download][View] Facility Assigned ID: TMGGI19TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0187 Quality Trim Threshold: 14.5