Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E247402

Search information 
Request: 247402Match: SGN-E247402
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C28148Clone name: cLEF-46-L19
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176907 is on microarray TOM1: SGN-S1-1-8.3.8.9
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176907 [TUS-25-C17] Trace: SGN-T181648 EST: SGN-E369786 Direction: 3' Facility: INRA
Clone: SGN-C176907 [TUS-25-C17] Trace: SGN-T181649 EST: SGN-E369787 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E247402Length: 567 bp (892 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E247402 [] (trimmed) ATTTGTTGTGGTCTGACCCAACAGAAAATGATAGTGTTGAAGGACTAAGACCAAATGCAAGAAGCCCTGGCTTGGTAACTTTTGGGCCCGATCGT
GTGATGGAGTTTTGCAACAACAATGATCTTCAACTAATAGTCCGAGCCCACGAATGCGTGATGGATGGCTTTGAAAGATTTGCTCAAGGGCATTT
GATTACGCTTTTTTCAGCCACCAATTACTGCGGTACTGCTAACAATGCTGGTGCCATTTTAGTACTGGGTAGAGATCTTGTTGTGGTTCCAAAAC
TTATCCACCCAATTCCGCCAGTTTCATCGCCTGAAAATTCACCTGAACGGCATATAGAAGACACTTGGATGCAGGAGTTAAATGCTAACAGACCC
CCTACACCAACCAGAAGCCGTCCCCAAGTTGCGAACGATCGAAGTTCTTTTGCTTGGACTTAGATTCTTTTCCTATACTTTGAGCTTCATGCTCT
TAACATCTGGGATTTCCAGTGATATGTACATAGGCATGAAGCCATTTGTGGAGACAAATATATCCCTCTTTGAAGATCTATAAGGCTTTTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E247402] SGN-U572555 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T61813 [Download][View] Facility Assigned ID: TMGHA70TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.981 Expected Error Rate: 0.0120 Quality Trim Threshold: 14.5