EST details — SGN-E247031

Search information 
Request: 247031Match: SGN-E247031
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C26616Clone name: cLEF-41-B1
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176376 is on microarray TOM1: SGN-S1-1-3.1.10.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176376 [TUS-23-M14] Trace: SGN-T181244 EST: SGN-E369206 Direction: 3' Facility: INRA
Clone: SGN-C176376 [TUS-23-M14] Trace: SGN-T181245 EST: SGN-E369207 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E247031Length: 443 bp (958 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E247031 [] (trimmed) ATCATGAGCCCTTGTGGATATGAAGCTACTGTTTGCTGGCTTGAGATGATTATATGCAACTTAATTTTTAGAAGAAAAGTTTTGTATCCTGGCAA
TTGCTCGAGATTCTAATTTTTTTATGCTACAGGGAGCTTCTGGTGTTGCCGCAAGCACATAATGGCGTCCAAGTATCATGGACCAATCAACAGAA
CACGGCGACCGATCTCTATATTAATTGTAATTGGTCTTTGTTGTTTCTGTTATCTAATAGGAATTTGGCAGAAAAGTGGATCCGGAAAGGGAGAT
AAATTAGCACTACAAGTGACTGAGCAAACTGCTGACTGCAATGTTTTTCCACAAACCACTCTGGATTTTGAGTCACACCATAATTATGTGGAAAC
GGTTGAAACTTCAGAACTAACAGTTAAAAGATTCAAATCATGTGAAGCTAAATACACTGACTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E247031] SGN-U583160 Tomato 200607 Build 2 95 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T60446 [Download][View] Facility Assigned ID: TMGGG01TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0112 Quality Trim Threshold: 14.5