Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E246633

Search information 
Request: 246633Match: SGN-E246633
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C27911Clone name: cLEF-45-P22
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176802 is on microarray TOM1: SGN-S1-1-1.3.9.13
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176802 [TUS-24-O8] Trace: SGN-T193108 EST: SGN-E391782 Direction: 5' Facility: INRA
Clone: SGN-C176802 [TUS-24-O8] Trace: SGN-T199146 EST: SGN-E397820 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E246633Length: 255 bp (864 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E246633 [] (trimmed) TTTTGTTGCATTCACACTATTATAGCCTTATTTGTCAACCAGCCGTTGTCCTCCTCGCCATTTTCTGTTTTAACAGCTTCTCCTCCCCTGTTCTG
ATCACTCCATTTTTCTCTTTCTCTCAATTTTTGCATTTTTCGATCTCTCTACAGATCCGACGTACGTATTGGATCCGGGCCGTCCGAACCGATAG
AATGGCGGCATCACGTCGTCTCCTGGATGTACAGGCGCAAACGGTGTGCAAGGGATGAATGTGTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E246633] SGN-U583230 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T61368 [Download][View] Facility Assigned ID: TMGGX95TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.924 Expected Error Rate: 0.0211 Quality Trim Threshold: 14.5