EST details — SGN-E245715

Search information 
Request: 245715Match: SGN-E245715
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C28601Clone name: cLEF-48-E22
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C183313 is on microarray TOM1: SGN-S1-1-2.2.3.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183313 [TUS-41-N15] Trace: SGN-T195194 EST: SGN-E393868 Direction: 3' Facility: INRA
Clone: SGN-C183313 [TUS-41-N15] Trace: SGN-T195351 EST: SGN-E394025 Direction: 5' Facility: INRA
Clone: SGN-C183313 [TUS-41-N15] Trace: SGN-T195638 EST: SGN-E394312 Direction: 5' Facility: INRA
Clone: SGN-C183313 [TUS-41-N15] Trace: SGN-T195638 EST: SGN-E398879 Direction: 5' Facility: INRA
Clone: SGN-C183313 [TUS-41-N15] Trace: SGN-T195824 EST: SGN-E394498 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E245715Length: 566 bp (882 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E245715 [] (trimmed) CGAGACGAAACCGATGTGTTAATTCAGCTGAAGATATGATTGATTTCGCAACATCAGTGTTGGGTCGAAACGTCGTCGTTCGAACGACTGAGGAT
ACAAAAGGATCAAATGGGAATATCATGATTGGATCAGTCAAAGGAATCAACGGTGGAAAAGTTACTAAATCAGTATCATGTCATCAAACGCTGTA
CCCTTACTTACTGTATTACTGTCATTCGGTTCCTAAAGTCCGGGTCTACGAAGCGGATATTTTGGACCCGAATTCAAAGGTTAAGATCAATCATG
GTGTCGCGATTTGCCACGTGGATACCATCTTCATGGGGACCGAGTCACGGAGCGTTTGTCGCACTCGGGTCGGGACCCGGGAAAATAGAAGTTTG
TCATTGGATCTTTGAGAATGATATGACTTGGGCAATTGCTGATTGAGAAAAAAAAAAGAAATGAAATAATATGCAAAATTTCTAATTCGGGTCGA
ACCGGGTGTGTTACAAGAAGAAGAAAAAAGGTACCACTGGTTTGACTTTTATAGTAATTATTATTATTATAGTCTTAATTTATATTTTGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E245715] SGN-U586540 Tomato 200607 Build 2 101 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T62204 [Download][View] Facility Assigned ID: TMGHH35TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0101 Quality Trim Threshold: 14.5