Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E242532

Search information 
Request: 242532Match: SGN-E242532
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C20873Clone name: cLED-30-O6
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C176171 is on microarray TOM1: SGN-S1-1-8.1.11.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176171 [TUS-23-E1] Trace: SGN-T180966 EST: SGN-E369392 Direction: 3' Facility: INRA
Clone: SGN-C176171 [TUS-23-E1] Trace: SGN-T180967 EST: SGN-E369393 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E242532Length: 269 bp (900 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E242532 [] (trimmed) CATGTATTCCCAGCATCAACCACTTCTATTCCAATCTATGGAGAACATCACCAGGGGTCGACTGATAGATGTGGACTACCCTTATGTAAGAAATC
ACTTTCAGCTAGCATGGCCACAGGAAGTGGTGATTTTCGTTGTTGGTGGGACAACATATGAAGAGTCACGTTCGGATGCTCTACAGAACTTTCCA
AACTCTGGAGATTGGTTTATACTTGGAGGTTCTTCCCTTTTAAATTCTAAAAGATTCTTGAAGGACCTTGAAGAAGCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E242532] SGN-U589288 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T56462 [Download][View] Facility Assigned ID: TOVEN87TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.981 Expected Error Rate: 0.0310 Quality Trim Threshold: 14.5