EST details — SGN-E241633

Search information 
Request: 241633Match: SGN-E241633
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C22091Clone name: cLED-36-H19
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C185629 is on microarray TOM1: SGN-S1-1-6.3.9.1
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185629 [TUS-47-O3] Trace: SGN-T192097 EST: SGN-E390771 Direction: 5' Facility: INRA
Clone: SGN-C185629 [TUS-47-O3] Trace: SGN-T192603 EST: SGN-E391277 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E241633Length: 539 bp (749 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E241633 [] (trimmed) TTTTTTTCTACCATCTCACAATTTTTCTTCCCCTTCAGCCCAATGTCGCCGGCGACTTTCTGACCTGCTCGATAACCTCCGTCTCTCTCTCCGTT
CGAAACAGATTTCTAGGGTTTTGGATTGTTGATTCAAATTTATACATATCGGAATAAGACGATGGCAGCTCCACCAGCTAGGGCTCGAGCAGATT
ATGATTATCTCATCAAGCTTCTCCTCATTGGCGATAGCGGTGTGGGAAAGAGTTGTTTACTTCTGAGATTCTCAGACGGATCCTTCACAACAAGT
TTCATCACAACTATTGGAATTGATTTTAAGATAAGAACAATTGAACTTGATGGCAAGCGGATTAAGTTACAAATTTGGGATACAGCTGGTCAAGA
GCGTTTCCGCACTATCACAACAGCGTATTACCGAGGAGCAATGGGGATTCTGCTGGTGTATGATGTCACGGACGAGTCTTCTTTCAATAACATCA
GGAACTGGATTCGCAACATAGAGCAGCATGCTTCTGATAATGTCAACAAGATTTTGGTCGGGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E241633] SGN-U578346 Tomato 200607 Build 2 43 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T57803 [Download][View] Facility Assigned ID: TOVFM46TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0067 Quality Trim Threshold: 14.5