EST details — SGN-C24042

Search information 
Request: 24042Match: SGN-C24042
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C24042Clone name: cLED-7-A23
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175175 is on microarray TOM1: SGN-S1-1-4.3.13.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C175175 [TUS-20-K13] Trace: SGN-T189780 EST: SGN-E377025 Direction: 3' Facility: INRA
Clone: SGN-C175175 [TUS-20-K13] Trace: SGN-T189781 EST: SGN-E377026 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E231789Length: 264 bp (782 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E231789 [] (trimmed) CAGATTTGACACCGCTGAAGAAGCTGCTCTGGCTTACGACAAGGCGGCGTATATGCTTCGTGGCGACTTTGCTCGACTGAACTTCCCTCAACTCC
GCCACAACGGCAACCTAATCGGCGGCGACTTTGGTGAATACAATCCATTGCATTCCTCAGTTGATGCTAAGCTAAAGGACATATGCCAAAGCTTG
GCACAGGGGAAGAGCATTGACTCTAAGAAGAAGAAAACCAAAGGGTTGTCGGCGGAGAAAGCGGCGGTGGTGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E231789] SGN-U579555 Tomato 200607 Build 2 111 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T50298 [Download][View] Facility Assigned ID: TOVAY12TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.981 Expected Error Rate: 0.0127 Quality Trim Threshold: 14.5