EST details — SGN-E235443

Search information 
Request: 235443Match: SGN-E235443
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C15250Clone name: cLED-11-G1
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175433 is on microarray TOM1: SGN-S1-1-2.2.13.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C175433 [TUS-21-F7] Trace: SGN-T190521 EST: SGN-E377759 Direction: 3' Facility: INRA
Clone: SGN-C175433 [TUS-21-F7] Trace: SGN-T190522 EST: SGN-E377760 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E235443Length: 336 bp (903 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E235443 [] (trimmed) TTTTCATCTTCGGCATTTGATCATGGCGGCAACTGCTCACAATAATCTCAATGCAAAACTCGTGTTGTTGGGGGACATGGGAGCTGGTAAATCAA
GCTTGGTTATACGATTCGTCAAGGGACAATTCCTTGAATTCCAAGAATCGACGATCGGAGCGGCTTTCTTTTCCTCTACTGTTTCGGTTAACAAT
TCTACGGTGAAGTTTGAGATCTGGGATACTGCTGGTCAGGAGAGGTACCATAGCTTAACGCCTATGTATTACAGGGGTGCTGCAGCAGCTATTAT
CGTCTATGACATCACCAGCACTGATTCATTTGCACGGGCAAAGAAATGGGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E235443] SGN-U579529 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T51453 [Download][View] Facility Assigned ID: TOVBO37TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.982 Expected Error Rate: 0.0190 Quality Trim Threshold: 14.5