EST details — SGN-C23528

Search information 
Request: 23528Match: SGN-C23528
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C23528Clone name: cLED-5-K16
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C174759 is on microarray TOM1: SGN-S1-1-4.2.15.6
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174759 [TUS-19-J5] Trace: SGN-T189507 EST: SGN-E376893 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E231018Length: 351 bp (431 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E231018 [] (trimmed) CAGCAAGGAACTTTTTATGTCCGATCACCGAGATATACAAAGTGCCGACACAATTGAAGGCAAGTGTACGGTCCACACATTCAAGAGCTACACCA
AACTCGACGCTGTTGGGAACGAAGACTTCTTTTGCCGATTTGACTACAATTCTTCTACCGGAGCATTTAATCCTGACAGAGTTGCTGTGTACTGT
AAATGTGAAATGCCATACAATCCTGATGACCTCATGGTTCAATGTGAGGGCTGCAGTGACTGGTTTCACCCTACTTGTATAGACATGACGCCAGA
GGAAGCCAAGAGACTTGACCACTTCTTTTGCCAAAATTGTTCATCTGAAGATCAGAAGAAATTGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E231018] SGN-U574965 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T49634 [Download][View] Facility Assigned ID: TOVAR68TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0001 Quality Trim Threshold: 14.5