EST details — SGN-E234773

Search information 
Request: 234773Match: SGN-E234773
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C59990Clone name: cLEL-6-P13
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C59990 [cLEL-6-P13] Trace: SGN-T17839 EST: SGN-E235061 Direction: 3' Facility: Cereon
Clone: SGN-C59990 [cLEL-6-P13] Trace: SGN-T22243 EST: SGN-E280812 Direction: 3' Facility: Novartis
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E234773Length: 236 bp (916 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E234773 [] (trimmed) AAAGGAGAGAGACTGTTTCCAGTCGACAATTAGTCAAGACTCATAATTGAAAAAGAAACATGATTGTTTTCAAATAAACTCCAACCAAAACTGAT
TTGATAAGTAAACATCTAAATTTTACACTCTAAAGAACAATTGTAGAAGTTCTCAAAGCAAAATCTAACAAAGGAGTGCCCAAAGGGTCCGGCAA
ATACGCTGGTATCATCAAAAGCCAAGTATTAATAAATGATGGAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E234773] SGN-U569741 Tomato 200607 Build 2 20 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T17551 [Download][View] Facility Assigned ID: cC-esflcLEL6P13d1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.912 Expected Error Rate: 0.0230 Quality Trim Threshold: 14.5