EST details — SGN-E233659

Search information 
Request: 233659Match: SGN-E233659
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C15905Clone name: cLED-14-G24
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C181418 is on microarray TOM1: SGN-S1-1-1.3.14.2
See unigene SGN-U578039 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C181418 [TUS-36-O16] Trace: SGN-T193590 EST: SGN-E392264 Direction: 5' Facility: INRA
Clone: SGN-C181418 [TUS-36-O16] Trace: SGN-T193823 EST: SGN-E392497 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E233659Length: 545 bp (858 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E233659 [] (trimmed) CAGGCTTCTGGGGTTGAGTTGAGTTACCGATAACGTCCATTTTCTTAGCGGGGTTTCTAATATATTCTTTGATTTTGTTGAATAGGTCCATTTGC
TTACACAAAAATTGCATATAAGGGAGAAAGGAAAGGAAAACTCAGAGCAAAGTGAACCAATTAGTCCAATAGACACACAAGAGGCTCAAAAAGCA
ACAACTCCAATTGTTGTTACCTCAAATGTACCAAAGTTAATGTGCAAACAAGAAGATGCAACATCAGCAAAAAGTGATGTTATTGATTCAGATAG
CCCACATTACACTGATGGGAATCATTCATCAAATGTATTTGAACAAGAGCCATCTGATTTTTCTCGAGATGAAGATGACAACCTAAGCAAGAACT
TTCTATATTTCCCCGAAATCGGAGATCAAATTCAAGCGAATTCATGCAATTTGAGTTTCCAAATTGAAGATCAACCTTGTTGGTTCTGGCAATAT
TGAGTTGTTAGGTTACAAGATTTGGCTCGATCCTACTTTAGATCAGTATAAATCCCACAAGTGGAGTCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E233659] SGN-U578039 Tomato 200607 Build 2 54 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T52013 [Download][View] Facility Assigned ID: TOVCB48THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0027 Quality Trim Threshold: 14.5