EST details — SGN-E233198

Search information 
Request: 233198Match: SGN-E233198
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C23688Clone name: cLED-6-B18
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C181281 is on microarray TOM1: SGN-S1-1-2.1.14.5
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181281 [TUS-36-I23] Trace: SGN-T187575 EST: SGN-E375017 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E233198Length: 247 bp (807 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E233198 [] (trimmed) CAGGTACAGTCACGAGCTTGACATGGGATTGCGATACAGATAGTTGATCAGGGAACGAGTCGGTAGCTACATTTGCAACTGGGTACCATGTTTTC
TTTTCCTGGTTTGACTGAGAATCCGTTGTTACAACTTTACCATGTTGTACTGCCTTTACCATCGAACCAAAGAATTGGAAACCATGCTGGCCTTC
TGCTTTTTAGCATGAGGTACAGACATGTAGACTCCTGGAAAGTTGTGTAATTTTAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E233198] SGN-U566700 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T50184 [Download][View] Facility Assigned ID: TOVAX09TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0013 Quality Trim Threshold: 12.5