EST details — SGN-E233051

Search information 
Request: 233051Match: SGN-E233051
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C24006Clone name: cLED-6-O9
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175146 is on microarray TOM1: SGN-S1-1-1.2.14.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C175146 [TUS-20-J8] Trace: SGN-T190133 EST: SGN-E377911 Direction: 3' Facility: INRA
Clone: SGN-C175146 [TUS-20-J8] Trace: SGN-T190134 EST: SGN-E377912 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E233051Length: 291 bp (770 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E233051 [] (trimmed) TTTTAACTCTTCCATTTACTTATCCTATTTAATGTCATGGTATTTCATGATAGATGGATTAGTGTCTGACAATTGATCTGATTATGTGTCCTTCA
ACTATATATGAGTTTTGGGATAATGTAGTCTTTTATTGTCAGATTTATATACATTAACATGTAAAATTAGAGGGAACTTTCAGTTCTGTGTTGTA
CTATTACAATGATAGCTCTAGTGTCGTTGATGTAAGACAATATCTACTCTTTCAATCACTTAATGTAAGAATCAAGACTTCATCTAATCAAATAT
TAGCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E233051] SGN-U564952 Tomato 200607 Build 2 63 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T50037 [Download][View] Facility Assigned ID: TOVAU89TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.896 Expected Error Rate: 0.0001 Quality Trim Threshold: 12.5