Notice: the solgenomics has been unstable, we apologize for the inconvenience.

EST details — SGN-E232951

Search information 
Request: 232951Match: SGN-E232951
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C23948Clone name: cLED-6-M19
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175097 is on microarray TOM1: SGN-S1-1-2.4.14.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C175097 [TUS-20-H7] Trace: SGN-T1345 EST: SGN-E378256 Direction: 5' Facility: Giov. Lab
Clone: SGN-C175097 [TUS-20-H7] Trace: SGN-T189975 EST: SGN-E377476 Direction: 3' Facility: INRA
Clone: SGN-C175097 [TUS-20-H7] Trace: SGN-T189976 EST: SGN-E377477 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E232951Length: 420 bp (515 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E232951 [] (trimmed) ACAAATTATAAGAGGCTGAAATGAATATATTATCGCTGTCAGCCTATTATTGCAGTGAGTTTTTTCCTTCTTTGATGATTCCGATTATCTCCCAC
TAATCCATTTCCCCGATTCAACCAATCCCAAACCTTACGGGAAATAGTTGTGTCTTGATTGATTCATGACTAACTCTTTTAGGAAGAAGTATGAA
GTCTTTTTTCCCCCTCTATTTTATTATGTTTTTCAATACTATCCTCAGCCAAAAGCAACAATAACAATTACGCCTCAATCCGAAACAGGTATTTT
CAACCAAGATACACGATTTAAACTTGTTTATGACATGCTGTCCAACTGTGAAATGCTTCATAGAGAGCGGTGGCGGAAAACATGTACATGTGATA
TAATTTGTTGAGGTTACACTCCCATCACAGTGCTACTGTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E232951] SGN-U584124 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T49937 [Download][View] Facility Assigned ID: TOVAU82TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.949 Expected Error Rate: 0.0024 Quality Trim Threshold: 14.5