Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-C23156

Search information 
Request: 23156Match: SGN-C23156
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C23156Clone name: cLED-4-K16
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C174518 is on microarray TOM1: SGN-S1-1-5.4.16.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174518 [TUS-18-P4] Trace: SGN-T197386 EST: SGN-E396060 Direction: 5' Facility: INRA
Clone: SGN-C174518 [TUS-18-P4] Trace: SGN-T199878 EST: SGN-E398552 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E231682Length: 530 bp (1205 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E231682 [] (trimmed) GCACCAGACAACCTCATCGTTTACAACATCAACTGGTGCTTACGAGGGGTCTTACGGAGATCAATTCCGTGGTGCTTCAGTGTATGGTGATCGAA
CTTGGCAAGGTGTGTCTTCTGATGCAGATGGTTCTGGTTCATTTGAATATGGTTTTGGAAATCCAGCTGATGTTTCTGCTAAAGAGTCTGAGGAT
TATATCGGAAATTATAATATTGCAAATAGGCAACCGAATAGAGGAATTGCAGCATAGATGATTTCGTTATTTCGATATCTGAAGATACTTAGGAG
AACAGACTTATAAGAGAAAGAAGTGGAAGTCGATGTTTATATAGTACCCCTCACAATATATATAGTTATATATATATATATAAGTATATTTCGGA
TATAAGAAAGCTGATCTCTAGAGCTAGTGAGGCGCTTGTCAGATTTAAAGGTGTTTTGTGACAGTTTGAAGTATCAATATAGTAAAAGCAATTAG
ACTTTTTTCAGCACTCGATCGAGATGTATATCAGATTTGCAAGGTATACATGATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E231682] SGN-U572258 Tomato 200607 Build 2 24 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T49451 [Download][View] Facility Assigned ID: TOVAN68TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0111 Quality Trim Threshold: 14.5