EST details — SGN-E231285

Search information 
Request: 231285Match: SGN-E231285
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C23500Clone name: cLED-5-J10
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C174739 is on microarray TOM1: SGN-S1-1-8.1.15.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174739 [TUS-19-I9] Trace: SGN-T197432 EST: SGN-E396106 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E231285Length: 365 bp (471 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E231285 [] (trimmed) ACTGATTGTGCCTCTACCATGTTCAGCTACATTAACCTTCACGGGAAGTACCCACCTGGTCTTTTCGCCAGTGAGTGCAATAAAGACAAAAATGG
GCTACCATGTCCTGATTCTGCATCATCCGAATCTGCCAGTGCTAATAATAGTCATATGAGCTGTAGACTATCACCGATCCTGATGATTGCAACAG
CTCTTACGGGCTTCTTCTTGTTGCTTCTCTGAAGATCTCTTCAAGGTTTTGGCGTAGTTTCTGTATTCTTTATTGTCAAATATTGTTTGAACTCC
GGATTTTCTTCTACCATGTTACCACTGATTAACGATCAACAAGAAACTCCTCCTCTTGTAATTCTTGATATATTACAACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E231285] SGN-U580923 Tomato 200607 Build 2 28 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T49901 [Download][View] Facility Assigned ID: TOVAT53TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0007 Quality Trim Threshold: 14.5