Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E231164

Search information 
Request: 231164Match: SGN-E231164
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C23302Clone name: cLED-5-A22
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C174615 is on microarray TOM1: SGN-S1-1-4.4.15.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174615 [TUS-19-D5] Trace: SGN-T189415 EST: SGN-E376801 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E231164Length: 338 bp (440 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E231164 [] (trimmed) CCGGAAATCAAGTTCCAACGCCGGGAAATCAAACTCCGGTGCTGATAAACACCAATCAGTATCACAATCACAACGACAATTTGAATAATTTCAAC
GAATTTTTCGCCAATTCAACGGCGTTAAATTTTCACGGTGAAGTTAAGTTTGAAGGAGGAGTTGATCAAGAAGTAGAAAGCAGTGTTAGAGCTCA
ACGACTTAACAGCGTTAACCCGGGTTTCTTCCAAGAGAACTCAACCGGGTTTTCAAGTTCTTATACAAACTCGGTACCCGACCCATTTGGGATTC
GGTACCCGACCCAAACAGTAAATATGGGTTTTACTGGGTAAATAGTGGAAGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E231164] SGN-U581139 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T49780 [Download][View] Facility Assigned ID: TOVAR11TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0015 Quality Trim Threshold: 14.5