EST details — SGN-C23048

Search information 
Request: 23048Match: SGN-C23048
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C23048Clone name: cLED-4-F23
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C174439 is on microarray TOM1: SGN-S1-1-4.4.15.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174439 [TUS-18-L21] Trace: SGN-T197278 EST: SGN-E395952 Direction: 5' Facility: INRA
Clone: SGN-C174439 [TUS-18-L21] Trace: SGN-T199860 EST: SGN-E398534 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E231525Length: 471 bp (1174 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E231525 [] (trimmed) CAGAGATCATCGTGCTGCTCAGATCCGTATGATTGAACAGGCTCTAAGTTTTGCTGCTATTTCTGAAGATCCAGCGAAGAAACCAACGTCCATAG
TTGATGTTGGATGTGGCATCGGTGGCAGTTCTAGGTACCTTGCAAAGAAATATGGCGCTACAGCTAAAGGTATCACTTTGAGTCCTGTACAAGCA
GAGAGGGCTCAAGCTCTTGCTGATGCTCAGGGATTAGGTGATAAGGTTTCATTTCAAGTAGCAGACGCCTTGAATCAGCCTTTTCCAGATGGGCA
ATTCGACTTGGTTTGGTCCATGGAGAGTGGAGAACACATGCCGAACAAAGAAAAGTTTGTTGGCGAATTAGCTCGAGTGGCAGCACCAGGAGGCA
CAATCATCCTTGTCACATGGTGCCACAGGGACCTTTCCCCTTCGGAGGAATCTCTGACTCCAGAGGAGAAAGAGCTGTTAAATAAGATATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E231525] SGN-U584511 Tomato 200607 Build 2 28 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T49294 [Download][View] Facility Assigned ID: TOVAO36TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.983 Expected Error Rate: 0.0085 Quality Trim Threshold: 14.5