EST details — SGN-E216827

Search information 
Request: 216827Match: SGN-E216827
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C53777Clone name: cLEL-1-G19
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C53777 [cLEL-1-G19] Trace: SGN-T2255 EST: SGN-E216739 Direction: 3' Facility: Cereon
Clone: SGN-C53777 [cLEL-1-G19] Trace: SGN-T20591 EST: SGN-E281422 Direction: 3' Facility: Novartis
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E216827Length: 487 bp (575 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E216827 [] (trimmed) AGCAACAAATTAACACTTGTTTCATAACTTAAGAGGGTAGCTAAAATAGTGAAATTTTACAAACAGTACATGGAATGTAATGAACATGGTCATGT
CCACTACACAAACTTACAACACCAAGAAACTAAAACCATCTTATTCCTACTATCATTTTTCACTGTTCCCTCGCATATAAATACACAAAGGAAGG
GGGGGAAAAGTGATAATGAGTACAAGCACATAAGAAAAAGCAGGATTGTTTTAGTGGAGCTTGTTGGCAAGATTACACTGCTTTCTGATCTCACC
TTTTGTCCCAGTAAGTGGATTATTCTCAGAAAGAATAGTGATGGCTCTTGCAAATTCCTTGAAGAAATAATTTTGGCTTTTTGCCATTTTCTTTA
CATATGGCTTAGTCCTCTTGTCCATTGCTAGTTGATGATCAACTAACATTAACCCCTTATTGTCCAATATGTTCCTGTAGTAGTTGTTGTCTAGA
ACCATGGGCGTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E216827] SGN-U577555 Tomato 200607 Build 2 210 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T2343 [Download][View] Facility Assigned ID: cC-esflcLEL1G19c1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.943 Expected Error Rate: 0.0061 Quality Trim Threshold: 14.5