EST details — SGN-E210546

Search information 
Request: 210546Match: SGN-E210546
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C6355Clone name: cLEC-35-D10
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173903 is on microarray TOM1: SGN-S1-1-4.2.17.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173903 [TUS-17-F13] Trace: SGN-T189136 EST: SGN-E376522 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E210546Length: 310 bp (929 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E210546 [] (trimmed) CAGATAACCAAAAGCTGTTACCTTTGGAATCCCTCTCCCTTGTCTTGTTAAACCCAATTCTGAGGTAGACTTTTATATTGGTCTTAATACAAAAA
TGGGAGCTTCCAAATCAGTTCCACAGAAATCAATCTATGAATTTACTGTAAAGGACAGCAAAGGGAAAAATGTAGACCTAAGCATCTATAAGGGA
AAAGGGCTTCTTGGTGTTAATGTTGCCTCTAAATGTGGGTTCACAAGCACAAATTATACCCAATTGACTCAACTCTACAACGAATACAAGGATAA
AGATTTTGAAGTCTTGGCCTTCCCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E210546] SGN-U570297 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T30894 [Download][View] Facility Assigned ID: TCAFJ17TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.939 Expected Error Rate: 0.0216 Quality Trim Threshold: 14.5