Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E210321

Search information 
Request: 210321Match: SGN-E210321
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C6543Clone name: cLEC-35-M12
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C184087 is on microarray TOM1: SGN-S1-1-4.2.18.6
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184087 [TUS-43-N21] Trace: SGN-T198070 EST: SGN-E396744 Direction: 3' Facility: INRA
Clone: SGN-C184087 [TUS-43-N21] Trace: SGN-T198071 EST: SGN-E396745 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E210321Length: 564 bp (854 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E210321 [] (trimmed) TTTAGTTGGGGAGCTTTTCTCGATAATCGCCAAATTTCCATAAATTCAAATCAGTATATCATCGAAGAACACGACGAAAATCCGATGGCCACAAG
CAAAACGACAGTTCAAATTCACGGAGATTGTGAAAATGATAAAGTGAAGTTACGTGGAGTAGTAGTTCAGTGAAGTAGTAGATACTGAGATCGCA
TTCTCCGTCGTCATTTTTCACATCGAAATAGTCGTGTAAAAAAAATGAAAAAATTGCTGCGAGACAGGTATGTGTCGCAGCAGGAAATAGCATCT
TAAAGGAAGGAAGGAAGGAAACTCGAAAGTTACTAAAAATTTTTGATTCTTTGGGACGAAACGAGATAATGGAATCCTGTGATTGCATTGAGGCT
TTACTGCCAACTGGTGACCTGCTGGTTAAATACCAATACCTCTCAGATTTCTTCATTGCTGTAGCCTACTTTTCCATTCCGTTGGAGCTTATTTA
TTTTGTCCACAAATCTGCATGCTTCCCATACAGATGGGTCCTCATGCAATTTGGTGCTTTTATTGTGCTCTGTGGAGCAACACACTTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E210321] SGN-U580538 Tomato 200607 Build 2 122 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T30669 [Download][View] Facility Assigned ID: TCAFH78TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0093 Quality Trim Threshold: 14.5