EST details — SGN-E210209

Search information 
Request: 210209Match: SGN-E210209
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C7976Clone name: cLEC-40-O10
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C174330 is on microarray TOM1: SGN-S1-1-1.4.16.14
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174330 [TUS-18-H8] Trace: SGN-T197338 EST: SGN-E396012 Direction: 3' Facility: INRA
Clone: SGN-C174330 [TUS-18-H8] Trace: SGN-T197339 EST: SGN-E396013 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E210209Length: 220 bp (655 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E210209 [] (trimmed) CCTGGAGCTCCAAATCCTCCACCCAGAGGCCCACCATCTGGATCAATGCCTCCACCCCCTCCCCTTATGGGTAACGGACCTAGACCTATGCCACC
AGGAGGTAACTTACCTGCCCCACCACCTCCTCCCGTTGGTGGTGGAGCTATGGCTAATTTCACTCCAAGTGGACACATGGGTAGACCTCCAATGA
TGCCTCCACAAGGTTTTCCAGGTCAACAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E210209] SGN-U579036 Tomato 200607 Build 2 45 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T32273 [Download][View] Facility Assigned ID: TCAGB89TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0544 Quality Trim Threshold: 12.5