| SGN ID: SGN-C7383 | Clone name: cLEC-38-L8 |  | Order Clone |
|
| Library Name: cLEC | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination
Microarray: Alias clone
SGN-C174230 is on microarray TOM1: SGN-S1-1-5.4.16.13
There is no map position defined on SGN for this EST or others in the same unigene.
| Sequence Id: SGN-E209206 | Length: 324 bp (1022 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E209206 [] (trimmed)
ATTGTTGAATATTGGATTGAAGCTGATTGCTTTGTGGAGACATGAATAGTGAGGATTCACATAGCCCAGCCTAATTAGCTTGGGATTTAGGTGGT
GTTGTTTTGATGTGGCTGCTTTTGAATTGTGTTAGTTAAGTGTAGCAGAAATGGATGTTAAATGTTTGATTTATAGAAGTTGGAAACGATCACAT
TCAACAATCAGTATAAATAGTATATATATAGGATAAAAGTTGTCGTTATGGCAATTCCACCAGTAACAAAATTTTGTGCATTGGTCTGGAGATCC
ATTATGCCTTCCACATTACTAATGCACAACCTTTTTTTT
[BLAST] [AA Translate]
| SGN-ID: SGN-T31741 [Download][View] |
Facility Assigned ID: TCAFV64TH
|
| Submitter: Koni |
Sequencing Facility: TIGR |
Funding Organization: National Science Foundation
| Processed By: SGN |
Basecalling Software: phred |
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
| Sequence Entropy: 0.934 |
Expected Error Rate: 0.0046 |
Quality Trim Threshold: 14.5 |