| SGN ID: SGN-C7211 | Clone name: cLEC-38-D2 |  | Order Clone |
|
| Library Name: cLEC | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination
Microarray: Alias clone
SGN-C174188 is on microarray TOM1: SGN-S1-1-7.2.16.17
There is no map position defined on SGN for this EST or others in the same unigene.
| Sequence Id: SGN-E209185 | Length: 328 bp (983 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E209185 [] (trimmed)
ATGTCACATAATGGACTGGGTAAATACCTAGGGAACACACATCCTAGCATCTTCAAAGCCTACTCGTGCCACGTCTAGATAACATCCCATTCTAG
TATCTAAACATTGTAGAACTTCTCCAACGTCGATAATAGGCATTGACCGACATAGGACATACTATCTAGACATAAAATCCGGAGTCTACCTTACT
CCGATGGAGGGTGTTCTAATTGCCAAGGGTCGAACTAGGATACATCCCATGTAGGCACATGGTTAAGGAATATTAAGTGCTCCTTTGTACTCTAG
TCTCATTCTCAAGTTGAGCTACTACCACAAGCATATTAATTCG
[BLAST] [AA Translate]
| SGN-ID: SGN-T31720 [Download][View] |
Facility Assigned ID: TCAFV13TH
|
| Submitter: Koni |
Sequencing Facility: TIGR |
Funding Organization: National Science Foundation
| Processed By: SGN |
Basecalling Software: phred |
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
| Sequence Entropy: 0.976 |
Expected Error Rate: 0.0191 |
Quality Trim Threshold: 14.5 |
